Powers of ten

Seeing like a virus, a person, a pandemic

No man is an island, entire of itself; every man is a piece of the continent, a part of the main; if a clod be washed away by the sea, Europe is the less, as well as if a promontory were, as well as if a manor of thy friends or of thine own were; any man’s death diminishes me, because I am involved in Mankind… —John Donne, Devotions Upon Emergent Occasions.


One meter.
We begin at the scale of a picnic blanket, where a man and woman recline in the sun. The breeze is fresh, the grass green and flower-flecked; Spring has come to this latitude. The woman rolls over and coughs into her hand; she can’t smell the sunscreen she applied two minutes ago.

Decimeter to centimeter.
Passing the layer of the skin, we note redness and swelling, signals of distress.

Centimer to millimeter.
Redness and swelling as an effect of the dilation of capillaries, the flow of lymph, pressure rising in the tissues.

Millimeter to micrometer to nanometer.
Droplets in the micron range arc through air; the smallest motes aerosolize. Flu can ride these tiny reservoirs, but it’s still unsettled whether such droplets carry the new coronavirus.

At micron scale, we’re in the capillaries, amongst cells—cells breaking open, shedding viral bodies, cytokine storm.

Focusing closer, closer, down to billionths of a meter, we enter the realm of viral bodies. The largest viruses, Pithovirus, are about 1.5 µm long (that’s 1500 nanometers). Infecting amoebas, they were discovered only in 2014, in melting permafrost.

Our current novel coronavirus is about 120 nm in diameter.

Sight becomes strange here; the ways we have of visualizing viruses domesticate the strangeness of vision at billionths of a meter. Early electron micrographs of virions, or viral bodies, looked like lunar landscapes—the virions lumpy and flaring white, standing forth from substrates of lunar gray, starkly shadowed.


From F. P. O. Nagler and G. Blake, The use of the electron microscope in diagnosis of Variola, Vaccinia, and Varicella. Journal of Bacteriology September 27, 1947.


The shadows are caused by spraying a fine layer of metal (often platinum) on the specimen at an oblique angle, to render it “visible” to the instrument; the technique is called metal-shadowing electron microscopy. These were among the first images of viruses, and they’re well-wrought, hard-won objects.

The optical and mechanical are entangled here in interesting ways. What does it mean to imagine things like shadows, colors, and textures, depth of field—all the menagerie of our meter-scale visual experience, at this magnitude? Writing for the New York Times, Carl Giaimo details the work of medical illustrators who use digital rendering tools to develop the picture of the virus used widely in the press. CDC illustrators Alissa Eckert and Dan Higgins play with color, shadow, texture, and focal depth to create what they call a “beauty shot” of a single virus. As Giaimo writes, this work “means bringing the unseeable into view.” Note that choice—not invisible; not microscopic—unseeable.


Alissa Eckert, Dan Higgins/CDC


None of this is to say that the image isn’t accurate, meaningful, or useful. Aesthetics operate here as text, with colors and textures organized syntactically into legible elements of a story about the virus as a form of life. Facts are made, but they’re not made up, as Donna Haraway likes to say.

Below the nanometer, where viruses do their work, we enter an especially uncanny realm. To “see” at this scale is to practice a grammar of abstraction. Once we’re at the resolution of tenths of nanometers (sometimes called ångströms), we encounter the bristling proteins. These are the biochemical connectors the virus uses to interface with our cells; like an ambitious motivational speaker with a clutch of HDMI, USB, and VGA adapters, the virion brings a diverse toolkit to the show. Below, we see 6LU7, the COVID-19 main protease—that’s the blue-green tangle—engaged with an inhibitor molecule shown in yellow and burnt sienna. So this, perhaps, is a hopeful visualization.


Liu, X., Zhang, B., Jin, Z., Yang, H., Rao, Z. The crystal structure of COVID-19 main protease in complex with an inhibitor N3


There is a peculiar aesthetics to this biochemical visual—like the mingled fever dream of Alexander Calder and Buckminster Fuller, it’s a tense, brittle structure, possessed with a kind of turgid vitality. As with images produced by illustrators and microscopists, this depiction is the product of a toolchain, a workflow—lab techniques like gel filtration; the application of theoretical models to data; heuristics designed into the software that produced the image—with tweaks introduced by human authors at many points along the way.

Another Times piece, by Carl Zimmer and Jonathan Corum, explores the genome of the new coronavirus, compact enough to fit into a news article in its entirety. The authors “read” through the genome, literally transposing its RNA gene by gene to indentify the proteins it produces:


This protein slows down the infected cell’s production of its own proteins. This sabotage forces the cell to make more virus proteins and prevents it from assembling antiviral proteins that could stop the virus.

auggagagccuugucccugguuucaacgagaaaacacacguccaacucaguuugccuguuuuacagguucgcgacgugcucguacguggcuuuggagacuccguggaggaggucuuaucagaggcacgucaacaucuuaaagauggcacuuguggcuuaguagaaguugaaaaaggcguuuugccucaacuugaacagcccuauguguucaucaaacguucggaugcucgaacugcaccucauggucauguuaugguugagcugguagcagaacucgaaggcauucaguacggucguaguggugagacacuugguguccuugucccucaugugggcgaaauaccaguggcuuaccgcaagguucuucuucguaagaacgguaauaaaggagcugguggccauaguuacggcgccgaucuaaagucauuugacuuaggcgacgagcuuggcacugauccuuaugaagauuuucaagaaaacuggaacacuaaacauagcagugguguuacccgugaacucaugcgugagcuuaacggaggg

Corum and Zimmer; model sources: RCSB Protein Data Bank headquartered at Rutgers University–New Brunswick; Ribosome from Heena Khatter et al., Nature; Proteins from Yang Zhang’s Research Group, University of Michigan.


With the ribosome coded letter by letter, we enter into another kind of seeability. The genetic basis of life on earth begins to seem like the Library of Babel imagined by Jorge Luis Borges—a vast compendium, less intent on the natural selection of fitness than the expression of variation. In Borges’s library, we’re the viruses, catching and snipping bits of code and carrying them from book to book. In the compendium of life, it’s books within books, virality implicated at every level.

But now I’m thinking more about the “unseeable,” of all there is in disease that can’t be seen. In order fully to work through the powers-of-ten conceit, I should cycle back up through the order of magnitudes, past the one-meter dimension to kilometers and thousands of kilometers.


Nextstrain.org; Screenshot used under a CC-BY-4.0 license.


At planetary scale, the virus looks like our supply chains, our information networks, our frequent-flier accounts. The new coronavirus is an example of what the critic and philosopher Timothy Morton calls a “hyperobject”—a thing happening at different scales, along myriad vectors and dimensions, its edges sensible in radically different ways. These scales aren’t arranged on a hierarchy of being, from the fundamental to the epiphenomenal; they’re all part of each other, nested, intimate to one another.

I began this letter with an extract from Donne’s “Devotions Upon Emergent Occasions,” which hymns human intimacy across dimensions of intimate interconnection. Donne wrote, from bed, while stricken during a typhus outbreak in 1623. I remember turning to these lines ten years ago last month, when my father was dying. Sitting by his bed, I was struck by the strange necessity of being there with him—wishing my children would not one day have to go through this with me, even as I realized there was no place else I wanted to be.

We might return to our picnicker, back at the one-meter scale, now waiting for a ventilator in a hospital bed, denied the warmth and gift of family, of familiar touch and reconciliation, which my father and I shared ten years ago. At the scale of less-than-a-meter, there is no social distancing for the healthcare workers saving lives and offering solace.

The proteins, the ribosome; the chains of transmission—none of these scalar realities are the cause of the pandemic, the source of its suffering, the explanation. For those, we need to look as much to scales where politics, ideology, incompetence, and mendacity are at play.


I suspect that Powers of Ten (1977), a short film by Ray & Charles Eaves, is a touchstone for many receiving this newsletter; you can see it here.

Share Anthropostures